View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13091_low_12 (Length: 282)
Name: NF13091_low_12
Description: NF13091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13091_low_12 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 106 - 282
Target Start/End: Complemental strand, 1158434 - 1158258
Alignment:
| Q |
106 |
atcaacatctccttttctttcctctttcactcgttaattcacaccaaacaatatatttaatgtactcccccttgacatctttttctttcttcccaccttc |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1158434 |
atcaacatctctttttctttcctctttcactcgttaattcacatcaaacaatatatttaatgtactcccccttgacatctttttctttcttcccaccatc |
1158335 |
T |
 |
| Q |
206 |
atcatctatcctcactttattctcacaatcaaacattaacatagtaaagtatactagataacgagtgtcatgactct |
282 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158334 |
atcatccatcctcactttattctcacaatcaaacattaacatagtaaagtatactagataacgagtgtcatgactct |
1158258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 41
Target Start/End: Complemental strand, 1158480 - 1158452
Alignment:
| Q |
13 |
aatatactagccgggtcaattggatgaag |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1158480 |
aatatactagccgggtcaattggatgaag |
1158452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University