View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13092_low_11 (Length: 239)
Name: NF13092_low_11
Description: NF13092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13092_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 115 - 228
Target Start/End: Complemental strand, 10234378 - 10234265
Alignment:
| Q |
115 |
gttacttattcactttaggcttattttacaatattagggccatgatattcaagtactcattccaactacatacaaatctgtttatgacaaaacacttgaa |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10234378 |
gttacttattcactttaagcttattttaccatattagggccatgatattcaagtactcattccaactgcatacaaatctgtttatgacaaaacacttgaa |
10234279 |
T |
 |
| Q |
215 |
gttaattctacata |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10234278 |
gttaattctacata |
10234265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 115 - 228
Target Start/End: Complemental strand, 8337262 - 8337149
Alignment:
| Q |
115 |
gttacttattcactttaggcttattttacaatattagggccatgatattcaagtactcattccaactacatacaaatctgtttatgacaaaacacttgaa |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8337262 |
gttacttattcactttaagcttattttaccatattagggccatgatattcaactactcattccaactgcatacaaatctgtttatgacaaaacacttgaa |
8337163 |
T |
 |
| Q |
215 |
gttaattctacata |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8337162 |
gttaattctacata |
8337149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University