View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13092_low_12 (Length: 237)
Name: NF13092_low_12
Description: NF13092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13092_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 33646964 - 33647175
Alignment:
| Q |
11 |
gtcgggagtggaagtattagttaccgaatatactatgactttaaacattgtgttaatatatgattagtttttgaattactcaaaaagtggcaaactagtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33646964 |
gtcgggagtggaagtattagttaccgaatatactatgactttaaacattgggttaatatatgattagtttttgaattactcaaaaagtggcaaactagtc |
33647063 |
T |
 |
| Q |
111 |
tagtagttctctcccttccttgtaattcaaggaacatgggtttgaactctgtccaaatttttatattttaattatccatacatttaagaactatattcca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33647064 |
tagtagttctctcccttccttgtaattcaaggaacatgggtttgaactctgtccaaatttttatattttaattatccatacatttaagaactatattcca |
33647163 |
T |
 |
| Q |
211 |
catcatcatatt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33647164 |
catcatcatatt |
33647175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University