View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13093_high_2 (Length: 256)
Name: NF13093_high_2
Description: NF13093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13093_high_2 |
 | |
|
| [»] scaffold0016 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 110
Target Start/End: Original strand, 6307843 - 6307913
Alignment:
| Q |
40 |
ggccatcacttagtaacttccttgaaccattccactaatacctatttagtaggaaccacgtacgattatat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307843 |
ggccatcacttagtaacttccttgaaccattccactaatacctatttagtaggaaccacgtacgattatat |
6307913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 149
Target Start/End: Original strand, 107776 - 107815
Alignment:
| Q |
110 |
tttcgtggaacacctagagggagcacttttcctattctat |
149 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
107776 |
tttcgtggaacacctagaggtagcacttttcctattctat |
107815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University