View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13093_low_2 (Length: 256)

Name: NF13093_low_2
Description: NF13093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13093_low_2
NF13093_low_2
[»] chr5 (1 HSPs)
chr5 (40-110)||(6307843-6307913)
[»] scaffold0016 (1 HSPs)
scaffold0016 (110-149)||(107776-107815)


Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 110
Target Start/End: Original strand, 6307843 - 6307913
Alignment:
40 ggccatcacttagtaacttccttgaaccattccactaatacctatttagtaggaaccacgtacgattatat 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6307843 ggccatcacttagtaacttccttgaaccattccactaatacctatttagtaggaaccacgtacgattatat 6307913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 110 - 149
Target Start/End: Original strand, 107776 - 107815
Alignment:
110 tttcgtggaacacctagagggagcacttttcctattctat 149  Q
    |||||||||||||||||||| |||||||||||||||||||    
107776 tttcgtggaacacctagaggtagcacttttcctattctat 107815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University