View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13095_low_9 (Length: 307)
Name: NF13095_low_9
Description: NF13095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13095_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 23 - 297
Target Start/End: Complemental strand, 45792044 - 45791768
Alignment:
| Q |
23 |
atgattattcacaagtataaaatatattctccaaaacttcctctctttcatgacgagtggacacaactcatacctcaattttgaaatttcctgcaacaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45792044 |
atgattattcacaagtataaaatatattctccaaaacttcctctctttcatgacatgtggacacaactcatacctcaattttgaaatttcctgcaacaaa |
45791945 |
T |
|
| Q |
123 |
gaataaactgaattgtgaaaggctagttttcaaaaatacctattgac--aaaagataagtaaaacacagaaggaagaataacatgtatacataaaacaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791944 |
aaataaactgaattgtgaaaggctagttttcaaaaatacctattgacaaaaaaaataagtaaaacacagaaggaagaataacatgtatacataaaacaaa |
45791845 |
T |
|
| Q |
221 |
ttatacaccaaggtgtcagattttactttcttcatgctaggttaacccaaaaataggcagtgctttttgaccctttg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791844 |
ttatacaccaaggtgtcagattttactttcttcatgctaggttaacccaaaaataggcagtgctttttgaccctttg |
45791768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University