View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_high_15 (Length: 417)
Name: NF13096_high_15
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 30 - 406
Target Start/End: Complemental strand, 9055856 - 9055484
Alignment:
| Q |
30 |
catcattaacccttcaaacctcaaaaatcaaacacannnnnnnnnnnnnngttcggtgttgttcagnnnnnnngtatcaaacactttctctctctatctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9055856 |
catcattaacccttcaaacctcaaaaatcaaacacactctctctct----gttcggtgttgttcagaaaaaaagtatcaaacactttctctctctatctt |
9055761 |
T |
 |
| Q |
130 |
tttcatctttttgttcaaccatgaagaagctctaccataaagcgacggttcatccatcaccaccggtgataaccgaccaactttccttccttccggcaac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055760 |
tttcatctttttgttcaaccatgaagaagctctaccataaagcgacggttcatccatcaccaccggtgataaccgaccaactttccttccttccggcaac |
9055661 |
T |
 |
| Q |
230 |
catccttaccctagcggcggcgctatcacctgaagacagagaagtcttagcttatctcatctattgttcatccacaacagccccaccaactttcagcaat |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9055660 |
catccttaccctagcggcggcgctatcacctgaagacagagaagtcttagcttatctcatctattgttcatccacaacagccccaccaactttcagcaat |
9055561 |
T |
 |
| Q |
330 |
ttctctggcaacccacgacggagcacggtcaagacaggcgatcatgcaactctgttcaactgcagctgtttctgatg |
406 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9055560 |
ttctccggaaacccacgacggagcacggtcaagacaggcgatcatgcaactctgttcaactgcagctgtttcagatg |
9055484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University