View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_high_34 (Length: 283)
Name: NF13096_high_34
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 272
Target Start/End: Complemental strand, 39676088 - 39675835
Alignment:
| Q |
18 |
gttacccacctcatacttttcagagagtgcctaaaatggtgatttggtatgattttaaagatgttatgattcttaatgttgatggcaacactattaggaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676088 |
gttacccacctcatactttccagagagtgcctaaaatggtgatttggtatgattttaaagatgttatgattcttaatgttgatggcaacactattaggaa |
39675989 |
T |
|
| Q |
118 |
tcatggagttgtcggtttgggtggcttggtgcaatttgatagtgatgattgcataattggactttatggtcacattgcctgcaataataaccttcatgta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39675988 |
tcatggagttgtcggtttgggtggcttggtgcaatttgatagtgatgattgcataattggattttatggtcacattgcctgcaacaataaccttcatgta |
39675889 |
T |
|
| Q |
218 |
taattactagccattttgtaaaggattcgcattagtttattttcttgtttatatt |
272 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39675888 |
taattacta-ccattttgtaaaggattcgcattagtttattttcttgtttatatt |
39675835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University