View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_high_37 (Length: 261)
Name: NF13096_high_37
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 40834887 - 40835105
Alignment:
| Q |
16 |
atcggatacatattgtgtgtgattaactcaaaatcgcgataatattatcaaattgaatcatgtcagtttcttaaattattatcgatgttgttgtgtttgt |
115 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834887 |
atcggatacatattgtatgtgattaacacaataccgtgataatattatcaaattgaatcatgtcagtttcttaaattattatcgatgttgttgtgtttgt |
40834986 |
T |
 |
| Q |
116 |
ccgtgtcgtgtctggtatctatgtttgggtctatggttcataaatgtttacctttggggatatttacatttacaattttacatttacatctgaatgtcct |
215 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40834987 |
ccgtgtcgtatccggtatctatgtttgggtctatggttcataaatgtttacctttggggttatttacatttacaattttacatttacatttgaatgtcct |
40835086 |
T |
 |
| Q |
216 |
tcaaatatatcaattggac |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40835087 |
tcaaatatatcaattggac |
40835105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 62 - 106
Target Start/End: Complemental strand, 2073984 - 2073940
Alignment:
| Q |
62 |
atcaaattgaatcatgtcagtttcttaaattattatcgatgttgt |
106 |
Q |
| |
|
|||||||||||| |||| | ||||| ||||||||||||||||||| |
|
|
| T |
2073984 |
atcaaattgaattatgttattttctcaaattattatcgatgttgt |
2073940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 105
Target Start/End: Complemental strand, 16630834 - 16630794
Alignment:
| Q |
65 |
aaattgaatcatgtcagtttcttaaattattatcgatgttg |
105 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
16630834 |
aaattgaattatgtcattttcttaaattattatcggtgttg |
16630794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University