View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_high_46 (Length: 248)
Name: NF13096_high_46
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 51729517 - 51729729
Alignment:
| Q |
14 |
cacagacctttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgttcgacttatcacgtagtagatctatggtaatgatctctct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729517 |
cacagacctttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgttcgacttatcacgtagtagatctatggtaatgatctctct |
51729616 |
T |
 |
| Q |
114 |
atcactttcttctctttctatgtccattaaggggaaggaaacgtagtgagaatcaaattatatcttcatgccattgtgctaattatctatctagtaaggt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729617 |
gtcactttcttctctttctatgtccattaaggggaaggaaacgtagtgagaatcaaattatatcttcatgccattgtgctaattatctatctagtaaggt |
51729716 |
T |
 |
| Q |
214 |
cccatatataccg |
226 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
51729717 |
cccgtatataccg |
51729729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 74
Target Start/End: Original strand, 351423 - 351475
Alignment:
| Q |
22 |
tttcggataaaatatgctagacaggatgttcatttatgtatgatgatctcgtt |
74 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
351423 |
tttcggataaaatatgctcggcaggatgttcatttatgtatgatggtctcgtt |
351475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University