View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_low_26 (Length: 320)
Name: NF13096_low_26
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 13 - 303
Target Start/End: Original strand, 30968024 - 30968314
Alignment:
| Q |
13 |
aatatagacgcaaaattttgtataaacattcgtgtaagttaaagttgcagccatgtgattaggagatcacaagtataagccgtgaaatcaacctcttgca |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30968024 |
aatatagacgcaaaattttgtataatcattcgtgtaagttaaagttgcagccatgtgattaggagatcacaagtataagctgtgaaatcaacctcttgca |
30968123 |
T |
 |
| Q |
113 |
aatgcaaagactgtttgaaattcttggaatttcggtagggcttaagtcaacccttacaaaattgtcttattagatgaagactgccaccacttataaactc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30968124 |
aatgcaaagactgtttgaaattcttggaatttcggtagggcttaagtcaacccttacaaaattgtcttattagatgaagactgccaccacttataaaccc |
30968223 |
T |
 |
| Q |
213 |
actttcaggactctgccatgacaattttcacttttatttacatgatgaaccttaccttttttatgtggtttcccgcttcatcccaaagaat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30968224 |
actttcaggactctgccatgacaattttcacttttatttacatgatgaaccttaccttttttatgtggtttcccgcttcatcccaaagaat |
30968314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University