View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_low_39 (Length: 259)
Name: NF13096_low_39
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 44842057 - 44842290
Alignment:
| Q |
8 |
tgagatggacatcatctaaagtctaataaacccaaaaactccttcggatttctaacctttaaatgaataactgattttaactttctttacttttggaaga |
107 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44842057 |
tgagatgtccattatctaaagtctaataaacccaaaaactccttcggatttctaacctttaaatgaataactgattttaactttctttacttttggaaga |
44842156 |
T |
 |
| Q |
108 |
ggagattatatactagtgtcaatctcctttctccctcttttttcaaaatcaaagaaaacgagtataactgttttttcctctcaaagccaatacttcatcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44842157 |
ggagattatatactagtgtcaatctcctttctccctcttttttcaaaatcaaagaaaacgagtataactgttttttcctctcaaagccaatagttcatcc |
44842256 |
T |
 |
| Q |
208 |
cttgcaacttctgcgatgtcgccaccaacgataa |
241 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
44842257 |
cttgcaacttctgtgatgtcgccaccaacgataa |
44842290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University