View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_low_40 (Length: 258)
Name: NF13096_low_40
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_low_40 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 258
Target Start/End: Original strand, 33904137 - 33904383
Alignment:
| Q |
15 |
atcactattaagatcaaccacttttttggcttagtgtaaagtccaatgatctcagatgcaattcaagaacccaagtgattgcatgtagaaggccaaggct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33904137 |
atcactattaagatcaaccacttttttggcttagtgtaaagtccaatggtctcagatgcaattcaagaacccaagtgattgcatgtagaaggccaaggct |
33904236 |
T |
 |
| Q |
115 |
tcccttatatctacactacatataggtgaaatccaaactgtttttgtgggaacaaattggccatcta---caggaatgcaaatgtcaatcccaaattgat |
211 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||| |
|
|
| T |
33904237 |
tcccttatatctacactacgtataggcgaaatccaaactgtttttgtgggaacaaattggtcatctacatcacgaatgcaaatgtcaatcccaaattgat |
33904336 |
T |
 |
| Q |
212 |
tttgatgtgaagagaatgacacgtcaatgttgtatttgtagcacccc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33904337 |
tttgatgtgaagagaatgacacgtcaatgttgcatttgtagcacccc |
33904383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University