View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13096_low_42 (Length: 250)
Name: NF13096_low_42
Description: NF13096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13096_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 40834773 - 40834546
Alignment:
| Q |
1 |
attggcccttcagcctatttttgcaataattttaatataaaaacagacacttggtttaatgnnnnnnnntatcattggaactgttaccttaatggtaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
40834773 |
attggcccttcagcctatttttgcaataattttaatataaaaacagacacttggtttaatgaaaa----tatcaatagaactgttaccttaatggtaaaa |
40834678 |
T |
|
| Q |
101 |
tctgcagagtagcacacatgttatgttaatcaacannnnnnnctgtagcacatcccgtgagttatgtacgtgtatgtatgacaattgacaataggatgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40834677 |
tctgcagagtagcacacatgttatgttaatcaacatttttttctgtagcacatcccgtgagttacgtacgtgtatgtatgacaattgacaataggatgag |
40834578 |
T |
|
| Q |
201 |
catctgaatgaatccatttgggttggaaaact |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40834577 |
catctgaatgaatccatttgggttggaaaact |
40834546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University