View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13098_high_13 (Length: 235)
Name: NF13098_high_13
Description: NF13098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13098_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 7942715 - 7942775
Alignment:
| Q |
157 |
ctaccattattgattaataccaataaacaactaacaaatttcaaaaattgtgtgaaactat |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7942715 |
ctaccattattgattaataccaataaataactaacaaatttcaaaaattgtgtgaaactat |
7942775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University