View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13098_low_9 (Length: 258)
Name: NF13098_low_9
Description: NF13098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13098_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 15393792 - 15393547
Alignment:
| Q |
1 |
ggcgacagttaactgtcgagagacatttcaaacttttattggtattttttagccatcttcaaggtgtaaacagcaattttctaataactatgcaattcga |
100 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15393792 |
ggcgacagttaactatcgagggacatttgaaacttttattggtattttttagccatcttcaaggtgtaaacagcaattttctaataactatgcaattcga |
15393693 |
T |
|
| Q |
101 |
------cttttctccctaatggtctctctcctatttctctaagtatgtgacttatcctctcttgtgttttctttgcgctatactatacttgcaaga-ccc |
193 |
Q |
| |
|
|||||||||| || || |||| |||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15393692 |
gcaaatcttttctcccaaacggcctctatcctatttctct-agtatatgacttatcctctc--gtgttttctttgcgctatactatacttgcaagacccc |
15393596 |
T |
|
| Q |
194 |
cactttactttttaccctaaaaagttatatattattgttactgttatttt |
243 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
15393595 |
cactttactttttaccctaaaaa-aaatatgctattgttactgttatttt |
15393547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University