View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13099_high_11 (Length: 351)
Name: NF13099_high_11
Description: NF13099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13099_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 45794546 - 45794871
Alignment:
| Q |
18 |
gtatcaattccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794546 |
gtatcaattccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcac |
45794645 |
T |
 |
| Q |
118 |
gcggagttcccaaacatgtcgaaccaacaagacttttatcactgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794646 |
gcggagttcccaaacatgtcgaaccaacaagacttttatcattgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctc |
45794745 |
T |
 |
| Q |
218 |
atatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcgatgcttcacaattatttgcgagttttgaattata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45794746 |
atatttgtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcggtgcttcacaattatttgcgagttttgaattata |
45794845 |
T |
 |
| Q |
318 |
gttgctgagtctcctttgatgatgtc |
343 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45794846 |
gttgctgagtctcctttgatgatgtc |
45794871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University