View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13099_high_12 (Length: 350)
Name: NF13099_high_12
Description: NF13099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13099_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 36715577 - 36715885
Alignment:
| Q |
19 |
gatgttcgtgtaaagagctttgacgatcttcagaaaaatggtaataaaaatattcgatatgataactttgctgacgaaggcgtct-actcgtttgatcca |
117 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36715577 |
gatgttcgtgttaagagctctgatgatcttcagaaaaatgataataaaaatattcgatatgataactttgctgacgaaggcgtcttactcgtttgatcca |
36715676 |
T |
|
| Q |
118 |
gatgcctgagagtgtacaaa-tcaacatcttgaaattattcacgaagagccacaagattttcaaaatgatagcataatgtcatggtcattgcaggttcct |
216 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715677 |
gatgcctgagagtgtacaaaatcaacatcttgaaattattcgggaagagccacaagattttcaaaatgatagcataatgtcatggtcattgcaggttcct |
36715776 |
T |
|
| Q |
217 |
cttttttcatatggccagtcatgataataccaaataaattgttcacatagaacatcttgaaattatttatggaataacatcagttattgcactctcacca |
316 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36715777 |
cttttttcatatggccagtcataataataccaaataaattgttcacatagaacatcttgaaattatttatggaataacatcagttattgcactctcacca |
36715876 |
T |
|
| Q |
317 |
aagttttct |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
36715877 |
aagttttct |
36715885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University