View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13099_high_14 (Length: 327)
Name: NF13099_high_14
Description: NF13099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13099_high_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 16 - 327
Target Start/End: Complemental strand, 15633388 - 15633077
Alignment:
| Q |
16 |
gtttcctctctcattcgccaattgagttcgttcagttctataggggtgacgacctcagttccgtatgtaagccgaaaaggagattcgcctgtggtcgaac |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15633388 |
gtttcctctctcattcaccaattgagttcgttcagttctataggggtgacgaccttggttccgtatgtaagccgaaaaggagattcgcctgtggtcgaac |
15633289 |
T |
 |
| Q |
116 |
gaggagtggtgcaatatgcccataacacaatatgaagttcctcagcccaatttcccttagcatcgtctaatagtcgtcgtattccgcataggatgactcg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15633288 |
gaggagtggtgcaatatgcccataacacaatatgaagttcctcagcccaatttcccttagcttcgtctaatagtcgtcgtattccgcataggatgactcg |
15633189 |
T |
 |
| Q |
216 |
attattagactttggttgcctgtttgtttggggatgctcgaccgaggtgaaactttgttagatgttttagttttttaaataatctcgggacttccgatca |
315 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15633188 |
atcattagactttggttgcctgtttgtttggggatgctcgaccgaggtgaaactttgttagatgttttagttttttaaataatctcgggacttccgatca |
15633089 |
T |
 |
| Q |
316 |
gtgaattatgtc |
327 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15633088 |
gtgaattatgtc |
15633077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University