View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1309_high_9 (Length: 319)
Name: NF1309_high_9
Description: NF1309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1309_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 225
Target Start/End: Original strand, 19704610 - 19704830
Alignment:
| Q |
5 |
gcggaaaccgcagagagccgcaactatacaagtccaagagagtcgaagtttcaacaagtgggaagaagtcagagttgtgttagtcacaatagatggggtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19704610 |
gcggaaaccgcagagagccgcaactatacaagtccaagagagtcgaagtttcaacaagtgggaagaagtcagagttgtgttagtcacaatagatggggtg |
19704709 |
T |
 |
| Q |
105 |
ctgcaaagaggagtcaagtcgcccgtgggatgctagtagaaaaccaaaggagtttcatgaatgtgaagaagatgtattcacaaggagcaacttctcagag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19704710 |
ctgcaaagaggagtcaagtcgcccgtgggatgctagtagaaaaccaaaggagtttcatgaatgtcaagaagatgtattcacaaggagcaacttctcagag |
19704809 |
T |
 |
| Q |
205 |
aagcaatgaatatttcagccc |
225 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
19704810 |
aagcaatgagtatttcagccc |
19704830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University