View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1309_low_19 (Length: 273)
Name: NF1309_low_19
Description: NF1309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1309_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 252
Target Start/End: Complemental strand, 20223044 - 20222822
Alignment:
| Q |
30 |
ggttttgaggaggtggtgaaggtgacgtggaatgtggtggtgaaagggtggagaggggttttcactttgatggattgtgaggggaaggtggggtttgtgg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| | |
|
|
| T |
20223044 |
ggttttgaggaggtggtgaaggtgacgtggaatgtagtggtgaaagggtggagaggagttttcactttgatggattatgaggggaaggtggggtttgttg |
20222945 |
T |
|
| Q |
130 |
ccggaagagaggagtggttttcgcaggagctaccggcgccaggttgttgttcgaagatggtggcgagttcggtcgtggcggatatgaaggtggggatgtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20222944 |
ccggaagagaggagtggttttcgcaggagctaccggcgccaggttgttgttcgaagatggtggcgagttcggtcgtggcggatatgaaggtggggatgtg |
20222845 |
T |
|
| Q |
230 |
cggttgtagagaaagtgatgatg |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20222844 |
cggttgtagagaaagtgatgatg |
20222822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University