View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1309_low_24 (Length: 253)
Name: NF1309_low_24
Description: NF1309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1309_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 31 - 241
Target Start/End: Original strand, 45367328 - 45367542
Alignment:
| Q |
31 |
tagtctaatagtagtagtatgaagtggttaaaggaaacaaaatatctagctatgattgtgagtgaatctgagagtgagtttgtttgtggaactcaagaag |
130 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367328 |
tagtctaatagtagtagtttgaagtggttaaaggaaacaaaatatctagctatgattgtgagtgaatctgagagtgagtttgtttgtggaactcaagaag |
45367427 |
T |
|
| Q |
131 |
atcaaaaacacattcacactgaactgaatcttcataccaacaaaaacatgaccatgcaaatgttccattccaaccttaattaa----cagttgtctgaaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45367428 |
atcaaaaacacattcacactgaactgaatcttcataccaacaaaaacatgaccatgcaaatgttccattccaaccttaattaacagtcagttgtctgaaa |
45367527 |
T |
|
| Q |
227 |
acatagttgtctgtg |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45367528 |
acatagttgtctgtg |
45367542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University