View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1309_low_30 (Length: 233)
Name: NF1309_low_30
Description: NF1309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1309_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 4822072 - 4821931
Alignment:
| Q |
79 |
ggggcatgtaaggcagctgcagcttttgaaggtggtcctggcaggggcacaagcagctgccgatggcgggggtcgcgacgatggaagtattggataatac |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822072 |
ggggcatgtaaggcagctgctgcttttgaaggtggtcctggaaggggcacaagcagctgccgatggcgggggtcgcgacgatggaagtattggataatac |
4821973 |
T |
|
| Q |
179 |
aatggtggtgctgattgcaggctgcaaagcttctttttcttc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4821972 |
aatggtggtgctgattgcaggctgcaaagcttcattttcttc |
4821931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 159 - 220
Target Start/End: Complemental strand, 4812010 - 4811949
Alignment:
| Q |
159 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4812010 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttc |
4811949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University