View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13100_high_3 (Length: 433)
Name: NF13100_high_3
Description: NF13100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13100_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 128 - 430
Target Start/End: Complemental strand, 40925138 - 40924837
Alignment:
| Q |
128 |
gttctaccgagttttacttttgacaattctgactaccccagccccagccatgaatctccgtggctgcctcttatactgtttgcttccattgttgtggttg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925138 |
gttctaccgagttttacttttgacaattctgattaccccagccccagccatgaatctccgtggctgcctcttatactgtttgcttccattgttgtggttg |
40925039 |
T |
|
| Q |
228 |
ctattgcagtgatattgatcttggcatacagtccaactttcttaaaatggctgcgttcacctcccaaaccaccacgggcagcggtggcacctttgcccct |
327 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925038 |
ctattgcagtgatattgatcttggcatacggtccaactttcttaaaatggctgcgttcacctcccaaaccaccacgggcagcggtggcacctttgcccct |
40924939 |
T |
|
| Q |
328 |
cactgagttgaacgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatgcaggtaacaacaagtacatttctttgatgatgtcc |
427 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| | |
|
|
| T |
40924938 |
cactgagttg-acgtcgtgcaggcactaccgccggagcaagattgagtccaatgaagacacaatacaggtaacaacaagtacatttctttgaggatgttc |
40924840 |
T |
|
| Q |
428 |
atc |
430 |
Q |
| |
|
||| |
|
|
| T |
40924839 |
atc |
40924837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University