View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13100_low_4 (Length: 318)
Name: NF13100_low_4
Description: NF13100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13100_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 316
Target Start/End: Complemental strand, 14959457 - 14959157
Alignment:
| Q |
19 |
ggattgtcttgttatcttggttggagacatttgtgaggtttgtgatgttttagtgaaatgggtaggtttttgataaggagattgagattgagtttaatgt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14959457 |
ggattgtcttgttatcttggttggagacatttgtgaggtttttgatgttttagtgaaatgcgtagatttttgataaggagattgagattgagtttaatgt |
14959358 |
T |
|
| Q |
119 |
ttgatgtatgaggattgtttggtttaggtaggtttggtgtttgtgatggaatgggtaatatgaaatggatataagtttgagctgaaatatgtcgaatttg |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14959357 |
ttgatgtataaggattgtttggtttaggtaggtttggtgtttgtgatggaatgagtaatatgaaatggatataagtttgagctgaaatatggcgaatttg |
14959258 |
T |
|
| Q |
219 |
tgaatattcgggtctcttgacaaatcctatcacgattttgtataattgtg---ccaaatttgtgtaactgtcaaatgatttttaaactactggaaatcat |
315 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14959257 |
tgaatattcgggtctcttgacaaatcttgtcacgattttgtataattgtgccaccatatttgtgtaactgtcaaatgatttttgaactactggaaatcat |
14959158 |
T |
|
| Q |
316 |
g |
316 |
Q |
| |
|
| |
|
|
| T |
14959157 |
g |
14959157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University