View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13100_low_6 (Length: 299)
Name: NF13100_low_6
Description: NF13100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13100_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 7723853 - 7724114
Alignment:
| Q |
1 |
cagaaccagaagatgcagtgtttctctccagcaatgactaacgagttccgtttcattgatgaaaccaatcatgattctgaaaatggcattccatttctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723853 |
cagaaccagaagatgcagtgtttctctccggcaattactaacgagttccgtttcattgatgaaaccaatcatgattctgaaaatggcattccatttctct |
7723952 |
T |
|
| Q |
101 |
cttggagactctgatagaacaagcctcgttcatgaaaaatattaataataatgttaaaatagtaatagatttagtaaagcagctaggacggtcaagacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723953 |
cttggagactctgatagaacaagcctcgttcatgaaaaatattaataataatgttataatagtaatagatttagtaaagcagctaggacggtcaagacca |
7724052 |
T |
|
| Q |
201 |
atgataatgatatgtagaagatgtttttgattgcgatggttctatggtatcgtcacatgatg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724053 |
atgataatgatatgtagaagatgtttttgattgcgatggttctatggtatcgtcacatgatg |
7724114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University