View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13100_low_8 (Length: 286)
Name: NF13100_low_8
Description: NF13100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13100_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 38271996 - 38272254
Alignment:
| Q |
18 |
agatagattggctcttaagcttctcaatctatcttccaacgccattctttttaagaccagaaatgcgaatctcgctctcctctgtagtgtttcttctcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
38271996 |
agatagattggctcttaagcttctcaatctatcttccaacgccattctttttaagaccagaaatgcgaatctcgctctcctctgtggcgtt-cttctcta |
38272094 |
T |
|
| Q |
118 |
tgtctttatgctatttattataaacagccgatgtgggactcagaaaacatggttcattataaagagtaacagcattcaaattgcattgcagcatacttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272095 |
tgtctttatgctatttattataaacagccgatgtgggactcagaaaacatggttcattataaagagtaacagcattcaaattgcattgcagcatacttct |
38272194 |
T |
|
| Q |
218 |
tgtgaaagacaatcatcattataatggaccagattttaaccgattttctcatggcctttg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272195 |
tgtgaaagacaatcatcattataatggaccagattttaaccgattttctcatggcctttg |
38272254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University