View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13101_high_11 (Length: 228)

Name: NF13101_high_11
Description: NF13101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13101_high_11
NF13101_high_11
[»] chr5 (1 HSPs)
chr5 (20-208)||(6831603-6831791)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 6831791 - 6831603
Alignment:
20 atgtgaggagatccctcataaccgtgactacataggcaagtacatagaaaccaaaatatattctctagaatgtaagtgctcatcagtaggacacctgtca 119  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
6831791 atgtgaggagatccctcataaccgtgactacaaaggcaagtacatagaaaccaaaatatattccctagaatgtaagtgctcatcagtaggacacctgtca 6831692  T
120 tgaagaaagcatcgaaatacaaaagacttagaaggaggataaactttttccaaataatcttgccccataaaatagtaacagttaggctt 208  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6831691 tgaaggaagcatcgaaatacaaaagacttagaaggaggataaactttttccaaataatcttgccccataaaatagtaacagttaggctt 6831603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University