View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13101_high_11 (Length: 228)
Name: NF13101_high_11
Description: NF13101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13101_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 6831791 - 6831603
Alignment:
| Q |
20 |
atgtgaggagatccctcataaccgtgactacataggcaagtacatagaaaccaaaatatattctctagaatgtaagtgctcatcagtaggacacctgtca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6831791 |
atgtgaggagatccctcataaccgtgactacaaaggcaagtacatagaaaccaaaatatattccctagaatgtaagtgctcatcagtaggacacctgtca |
6831692 |
T |
 |
| Q |
120 |
tgaagaaagcatcgaaatacaaaagacttagaaggaggataaactttttccaaataatcttgccccataaaatagtaacagttaggctt |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6831691 |
tgaaggaagcatcgaaatacaaaagacttagaaggaggataaactttttccaaataatcttgccccataaaatagtaacagttaggctt |
6831603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University