View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13101_high_8 (Length: 276)
Name: NF13101_high_8
Description: NF13101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13101_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 13879829 - 13879567
Alignment:
| Q |
1 |
ctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13879829 |
ctcttaccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgccactcca |
13879730 |
T |
|
| Q |
101 |
cgactcattcactatttcaacaccaatgagctgnnnnnnnnnnnnnnnnnnnnnnnngatgatgatgatcttgttctctgggattttacggagactgagg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13879729 |
cgactcattcgctatttcaacaccaatgagctgaacaacaacaacaacaacgatgatgatgatgat---cttgttctctgggattttacggagactgagg |
13879633 |
T |
|
| Q |
201 |
agtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13879632 |
agtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtg |
13879567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 5 - 130
Target Start/End: Complemental strand, 13875602 - 13875477
Alignment:
| Q |
5 |
taccactctttcatgtccgccgtgcctgcattcattcgccaccgccccttcgctactgccgccatgtctctggttgccatctcctacgctgctcctcgac |
104 |
Q |
| |
|
|||| ||| |||||| ||||||||||| || ||||||||| || |||| ||||||||||||||||||| || || |||||||||||| | || |||| || |
|
|
| T |
13875602 |
taccgctcattcatggccgccgtgccttcactcattcgccgccaccccgtcgctactgccgccatgtcactcgtagccatctcctacaccgcacctccac |
13875503 |
T |
|
| Q |
105 |
tcattcactatttcaacaccaatgag |
130 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
13875502 |
tcattcgctatttcaacaccaatgag |
13875477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 168 - 266
Target Start/End: Complemental strand, 13875448 - 13875350
Alignment:
| Q |
168 |
atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtg |
266 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||| ||||||| |||| |||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13875448 |
atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtg |
13875350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University