View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13101_low_15 (Length: 201)
Name: NF13101_low_15
Description: NF13101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13101_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 80 - 187
Target Start/End: Complemental strand, 54722905 - 54722798
Alignment:
| Q |
80 |
caccgccactaaaggacaaatctacatcnnnnnnnatgaacggataaaacctacttaaaataaaacacactaaactttcaaaaatttcctaaagcgctta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54722905 |
caccgccactaaaggacaaatctacatctttttctatgaacggataaaacctacttaaaataaaacacactaaattttcaaaaatttcctaaagcgctta |
54722806 |
T |
 |
| Q |
180 |
agaattat |
187 |
Q |
| |
|
|||||||| |
|
|
| T |
54722805 |
agaattat |
54722798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University