View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13101_low_6 (Length: 336)
Name: NF13101_low_6
Description: NF13101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13101_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 10820209 - 10820015
Alignment:
| Q |
20 |
caagcaaacaagaagctcttgctactatca----tactatgcacttatgcagtacgtgttcaatatgtttagacacctaaaatnnnnnnncttagtgtga |
115 |
Q |
| |
|
|||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10820209 |
caagcaaacaagaaactcttgctaccatcaatcatactatgcacttatgcagtacgtgttcaatatgtttagacacctaaaataaaaaaacttagtgtga |
10820110 |
T |
 |
| Q |
116 |
ccttttttggtgtgaatcaggtatcttttgtatgcaactataaaggttaatctatcgagccgggtagaaccataaataaattttattgtgagacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10820109 |
ccttttttggtgtgaatcaggtatcttttgtatgcaactacaaaggttaatctatcgaaccgggtagaaccacaaataaattttattgtgagacc |
10820015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 277 - 321
Target Start/End: Complemental strand, 10819959 - 10819915
Alignment:
| Q |
277 |
gcctcaccactatgacctcatgattcctctcattgccatgtgaat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10819959 |
gcctcaccactatgacctcatgattcctctcattgccatgtgaat |
10819915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University