View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13102_low_1 (Length: 369)
Name: NF13102_low_1
Description: NF13102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13102_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 169 - 353
Target Start/End: Original strand, 477537 - 477720
Alignment:
| Q |
169 |
acgcaatatgtgacattaattttaatttggtcttcattgacttcaagctttcatcactatgaatatgatcgatcgcaggtgtgaacaagtgcaatgtgca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
477537 |
acgcaatatgtgacattaattttaatttggtcttcattgacttcaagctttcatcactatgaatatgatcgatcgcaggtgtgaacaagtgcaatgtgca |
477636 |
T |
 |
| Q |
269 |
ttgatcccaaatcatgtggaagataaacaaaaatactctagtggtataatnnnnnnncatgcacgatggaaatcatcgtgacatt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
477637 |
ttgatcccaaatcatgtggaagataaacaaaaatactctagtggtataat-aaaaaacatgcacgatggaaatcatcgtgacatt |
477720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 477409 - 477460
Alignment:
| Q |
43 |
gttctattgatcttataacaatattacagattaacaaaagacttgaattact |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
477409 |
gttctattgatcttataacaatattacagattaacaaaagacttgaattact |
477460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University