View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13103_high_15 (Length: 295)
Name: NF13103_high_15
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13103_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 43 - 282
Target Start/End: Original strand, 51837040 - 51837281
Alignment:
| Q |
43 |
acaacaaacagggagataatgataccattgtggttgcatatgagagagttaaggagtagagcacaggcaaaaaggagtgttgtatgattgaattggcaag |
142 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837040 |
acaagaaacagggaaataatgataccattgtggttgcatatgagagagttaaggagtagagcacaggcaaaaaggagtgttgtatgattgaattggcaag |
51837139 |
T |
|
| Q |
143 |
cga-aaaaatttt-tgagctaaatcagcagttgtgagcatcagtatcccacaatagacccaagcagcattcaaacgatttctttccccttttcattttct |
240 |
Q |
| |
|
||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837140 |
cgacaaaaattttatgagcgaaatcagcagttgtgagcatcagtatcccacaatagacccaagcagcattcaaacgatttctttccccttttcattttct |
51837239 |
T |
|
| Q |
241 |
tacaaacaaacatttgctagattttgtttgtattgatgatgt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837240 |
tacaaacaaacatttgctagattttgtttgtattgatgatgt |
51837281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University