View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13103_high_16 (Length: 284)
Name: NF13103_high_16
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13103_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 45565753 - 45565492
Alignment:
| Q |
1 |
attctgcgtgcaaagagatgatgttgggcgaatggatgagaatgtggggtttgcgaattctctaacagatcaaagtttttctttgaagtgtgcttggagg |
100 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565753 |
attctgcgtgcaaagagatgatgttcggtgaatggatgagaatgtggggtttgcgaattctgtaacagatcaaagtttttctttgaagtgtgcttggagg |
45565654 |
T |
|
| Q |
101 |
tattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565653 |
tattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaagc |
45565554 |
T |
|
| Q |
201 |
ggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565553 |
ggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg |
45565492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 191
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
| Q |
159 |
ccccattgtgaaacaaactatgagaacgattgg |
191 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
45286940 |
ccccattgtgaaacaaactacgagaacgattgg |
45286972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University