View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13103_high_22 (Length: 234)
Name: NF13103_high_22
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13103_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 38390052 - 38389915
Alignment:
| Q |
1 |
ttgcaccatgactcttctaaatatgatggttttcgcctcacctaccttggttatgattttctcgccatcaaaaccatggttaacaaaggtgtctttgtct |
100 |
Q |
| |
|
||||| ||||||||| ||||||| ||||| || ||||| ||||||||||||||||||||||| ||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
38390052 |
ttgcatcatgactctactaaatacgatggcttccgccttacctaccttggttatgattttcttgccatcaaaactatggtcaataaaggtgtctttgtct |
38389953 |
T |
 |
| Q |
101 |
ctgttggtcgccagatcggtgttggaaaagaatctggt |
138 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38389952 |
ctgttggtcgccaaatcggtgttggaaaagaatctggt |
38389915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University