View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13103_high_25 (Length: 214)

Name: NF13103_high_25
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13103_high_25
NF13103_high_25
[»] chr3 (2 HSPs)
chr3 (1-202)||(51837429-51837630)
chr3 (97-156)||(40154788-40154847)
[»] chr4 (1 HSPs)
chr4 (74-134)||(26736567-26736627)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 51837429 - 51837630
Alignment:
1 atagggttccaactagaataatctctttaggtgtagggttttaactgttgtggatactcggcagaggtggatctagattttttatattgatttggataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||    
51837429 atagggttccaactagaataatctctttaggtgtagggttttaactgttgtggatactcggcagaggtggatctagacttttgatattgatttggataaa 51837528  T
101 atatcaaagaaacaatatatattaacaaagcgaaattgcgatgcattaaacacaacaacaaaaatggtttaggggtgtctttttaccaacctatcacagg 200  Q
    |||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51837529 atatcaaagaaataatatatattaacaaagcgaaattgtgatgcattaaacacaacaacaaaaatggtttaggggtgtctttttaccaacctatcacagg 51837628  T
201 tt 202  Q
    ||    
51837629 tt 51837630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 40154788 - 40154847
Alignment:
97 taaaatatcaaagaaacaatatatattaacaaagcgaaattgcgatgcattaaacacaac 156  Q
    ||||||||||||||||| ||||||||||||||| |||| ||| ||  |||||| ||||||    
40154788 taaaatatcaaagaaactatatatattaacaaaacgaacttgagacacattaagcacaac 40154847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 134
Target Start/End: Complemental strand, 26736627 - 26736567
Alignment:
74 tagattttttatattgatttggataaaatatcaaagaaacaatatatattaacaaagcgaa 134  Q
    |||| |||| |||||| | ||| ||||||||||||||||| ||||||||||| ||||||||    
26736627 tagacttttgatattggtgtggctaaaatatcaaagaaactatatatattaataaagcgaa 26736567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University