View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13103_high_25 (Length: 214)
Name: NF13103_high_25
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13103_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 51837429 - 51837630
Alignment:
| Q |
1 |
atagggttccaactagaataatctctttaggtgtagggttttaactgttgtggatactcggcagaggtggatctagattttttatattgatttggataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
51837429 |
atagggttccaactagaataatctctttaggtgtagggttttaactgttgtggatactcggcagaggtggatctagacttttgatattgatttggataaa |
51837528 |
T |
 |
| Q |
101 |
atatcaaagaaacaatatatattaacaaagcgaaattgcgatgcattaaacacaacaacaaaaatggtttaggggtgtctttttaccaacctatcacagg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837529 |
atatcaaagaaataatatatattaacaaagcgaaattgtgatgcattaaacacaacaacaaaaatggtttaggggtgtctttttaccaacctatcacagg |
51837628 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
51837629 |
tt |
51837630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 97 - 156
Target Start/End: Original strand, 40154788 - 40154847
Alignment:
| Q |
97 |
taaaatatcaaagaaacaatatatattaacaaagcgaaattgcgatgcattaaacacaac |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| ||| || |||||| |||||| |
|
|
| T |
40154788 |
taaaatatcaaagaaactatatatattaacaaaacgaacttgagacacattaagcacaac |
40154847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 134
Target Start/End: Complemental strand, 26736627 - 26736567
Alignment:
| Q |
74 |
tagattttttatattgatttggataaaatatcaaagaaacaatatatattaacaaagcgaa |
134 |
Q |
| |
|
|||| |||| |||||| | ||| ||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
26736627 |
tagacttttgatattggtgtggctaaaatatcaaagaaactatatatattaataaagcgaa |
26736567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University