View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13103_low_16 (Length: 284)

Name: NF13103_low_16
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13103_low_16
NF13103_low_16
[»] chr4 (1 HSPs)
chr4 (1-262)||(45565492-45565753)
[»] chr8 (1 HSPs)
chr8 (159-191)||(45286940-45286972)


Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 45565753 - 45565492
Alignment:
1 attctgcgtgcaaagagatgatgttgggcgaatggatgagaatgtggggtttgcgaattctctaacagatcaaagtttttctttgaagtgtgcttggagg 100  Q
    ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
45565753 attctgcgtgcaaagagatgatgttcggtgaatggatgagaatgtggggtttgcgaattctgtaacagatcaaagtttttctttgaagtgtgcttggagg 45565654  T
101 tattcttcctactcttatgagacttcaagagagaggagttctatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaagc 200  Q
    |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45565653 tattcttcctactcttatgagacttcaaaagagaggagttccatgttcaaatggatgtccccattgtgaaacaaactatgagaacgattggatgtaaagc 45565554  T
201 ggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45565553 ggcaaaacaaatatggtgcgaggctgatctgtgggattcagttagcagaggcgcaggtgctg 45565492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 191
Target Start/End: Original strand, 45286940 - 45286972
Alignment:
159 ccccattgtgaaacaaactatgagaacgattgg 191  Q
    |||||||||||||||||||| ||||||||||||    
45286940 ccccattgtgaaacaaactacgagaacgattgg 45286972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University