View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13103_low_23 (Length: 234)

Name: NF13103_low_23
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13103_low_23
NF13103_low_23
[»] chr4 (1 HSPs)
chr4 (1-138)||(38389915-38390052)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 38390052 - 38389915
Alignment:
1 ttgcaccatgactcttctaaatatgatggttttcgcctcacctaccttggttatgattttctcgccatcaaaaccatggttaacaaaggtgtctttgtct 100  Q
    ||||| ||||||||| ||||||| ||||| || ||||| ||||||||||||||||||||||| ||||||||||| ||||| || ||||||||||||||||    
38390052 ttgcatcatgactctactaaatacgatggcttccgccttacctaccttggttatgattttcttgccatcaaaactatggtcaataaaggtgtctttgtct 38389953  T
101 ctgttggtcgccagatcggtgttggaaaagaatctggt 138  Q
    ||||||||||||| ||||||||||||||||||||||||    
38389952 ctgttggtcgccaaatcggtgttggaaaagaatctggt 38389915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University