View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13103_low_29 (Length: 202)
Name: NF13103_low_29
Description: NF13103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13103_low_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 51837452 - 51837258
Alignment:
| Q |
8 |
agattattctagttggaaccctattgtggaaaagttgccaannnnnnnnn-accaaaaacaaactaaagaaagtgaattatatagaaaaattttaagttc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
51837452 |
agattattctagttggaaccctattgtggaaaagttgccaattttttttttaccaaaaacaaactaaagaaagtgaattatatagaaaaagtt-aagttc |
51837354 |
T |
 |
| Q |
107 |
atggtaatttatatactgtttacgaatagtaaagaataagctcctaaagcaaaaattatttgttaaaggcttacatcatcaatacaaacaaaatct |
202 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51837353 |
atggtgatttatatactgtttacgaatagtaaagaataagctcctaaagcaaaaattatttgttaaaggcttacatcatcaatacaaacaaaatct |
51837258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University