View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13105_high_10 (Length: 345)
Name: NF13105_high_10
Description: NF13105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13105_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 13 - 156
Target Start/End: Original strand, 34395962 - 34396109
Alignment:
| Q |
13 |
aatattgatttggggtgtgctcgaaaaagtcttgctctt----cgtattgataccactttctaattgagctcggtagtgnnnnnnnnagtttcatccttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
34395962 |
aatattgatttggggtgtgctcgaaaaagtcttgctcttggatcgtattgataccactttctatttgagctcggtagtgttttttttagtttcatccttg |
34396061 |
T |
 |
| Q |
109 |
acttgcttcttttcttcatataggttgcctgccttcatactaaatttg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34396062 |
acttgcttcttttcttcatataggttgcctgccttcatactaaatttg |
34396109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 267 - 327
Target Start/End: Original strand, 34396211 - 34396271
Alignment:
| Q |
267 |
gttatttgaatggttaactttgtagatttcccaacattggcttcaattttaactatatatg |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34396211 |
gttatttgaatggttaactttgtagatttcccaacattggcttcaattttaactatatatg |
34396271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University