View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13105_high_18 (Length: 216)
Name: NF13105_high_18
Description: NF13105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13105_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 95 - 198
Target Start/End: Complemental strand, 16800473 - 16800370
Alignment:
| Q |
95 |
ctagttttctacacaaactttcatcaaattttagtaacaattatattattctatatttaaatgatagcagttcatagatgtattgaatatactgattgtc |
194 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16800473 |
ctagttttctgcacaaactttcatcaaattttagtaacaattatattattctatatttaaatgatagcagttcatagatgtattgaatatactgattgtc |
16800374 |
T |
 |
| Q |
195 |
caga |
198 |
Q |
| |
|
|||| |
|
|
| T |
16800373 |
caga |
16800370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 16800551 - 16800504
Alignment:
| Q |
18 |
catcttcatatttctatttctctctcttatcgacgccaaaggtaaaca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16800551 |
catcttcatatttctatttctctctcttatcgacgccgaaggtaaaca |
16800504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University