View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13106_high_7 (Length: 240)
Name: NF13106_high_7
Description: NF13106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13106_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 6103431 - 6103209
Alignment:
| Q |
12 |
ggtgttaggatgtgttgttgttgaagataagtaaaattcagagaaggagttattagttattacagtgttggagatgaaacaaataaggagtaa-ttttag |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6103431 |
ggtgttaggatgtgttgttgttgaagacaagtaaaagtcagggaaggagttattagttattacagtgttggagatgaaacaaataaggagtaatttttag |
6103332 |
T |
|
| Q |
111 |
tttagggattttgatgtctgatgtaat-taataa----gcaattgttatgttagaattgagtgaaatgattgagtagtctctctgaattgttcttgattg |
205 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6103331 |
tttagggaatttgatgtctgatgtaatataataaatatgcaattgttatgttagaattgagtgaaatgattgagtagtctctttgaattgttcttgattg |
6103232 |
T |
|
| Q |
206 |
a-----atcaagggtgaaaaata |
223 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
6103231 |
aaagtgatcaagggtgaaaaata |
6103209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University