View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13106_low_6 (Length: 253)
Name: NF13106_low_6
Description: NF13106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13106_low_6 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 87 - 253
Target Start/End: Complemental strand, 6103599 - 6103433
Alignment:
| Q |
87 |
aaatttagtttgaccattattgactgggaaattttggtcctgtagacgttctttaatatttggttaagatttttatgttaaggaaaggattgattgtgag |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6103599 |
aaatttagtttgaccattattgactgggaaattttggtcctgtagacgttctttaatgtttggttaagatttttatgttaaggaaaggattgattgtgag |
6103500 |
T |
 |
| Q |
187 |
catttggtggaagaatgtgacggcaacggttagagaggattctgatggaatttgagagatggatcgt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6103499 |
catttggtggaagaatgtgacggcaacggttagagaggattctgatggaatttgagagatggatcgt |
6103433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 21460755 - 21460706
Alignment:
| Q |
161 |
atgttaaggaaaggattgattgtgagcatttggtggaagaatgtgacggc |
210 |
Q |
| |
|
|||||| ||| ||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
21460755 |
atgttagggagaggtttgagtgtgagcatttggtgaaagaatgtgacggc |
21460706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University