View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13106_low_9 (Length: 220)
Name: NF13106_low_9
Description: NF13106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13106_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 203
Target Start/End: Original strand, 12777813 - 12777998
Alignment:
| Q |
18 |
cagagaataatggaaatattggtggtggagggaactttgagtgactgtgtgaatctttgttggacatgcagtgcttgaaagaaaaaacaaaaggtacatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12777813 |
cagagaataatggaaatattggtggtggagggaactttgagtgactgtgtgaatctttgttggacatgcagtgcttgaaagaaaaaacaaaaggtacatt |
12777912 |
T |
 |
| Q |
118 |
caaatatcactgnnnnnnngtttcttaaaaattatctatatgtgatgattaccttttcatacatgtgatgattaaagtaagatttc |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12777913 |
caaatatcactgttttttattttcttaaaaattatctatatgtgatgattaccttttcatacatgtgatgattaaagtaagatttc |
12777998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University