View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13107_high_2 (Length: 240)
Name: NF13107_high_2
Description: NF13107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13107_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 2686116 - 2686324
Alignment:
| Q |
18 |
attttgtcggatcattcacgtttgtttctcttagaactaaatttccattatcgaaaagctgaagaacaagtgggttggtagcttttgtttgattcgaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2686116 |
attttgtcggatcattcacgtttgtttctcttagaactaaatttccattatcgaaaagctgaagaacaagtgggttggtagcttttgtttgattggaaga |
2686215 |
T |
|
| Q |
118 |
ccatatgaggttgttgtctgaatctgatgatgaattgagaagtactatgtttccattgtcaccgattttgaggtgactattggttgaattttgaagaggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2686216 |
ccatatgaggttgttgtctgaatctgatgatgaattgagaagtactatgtttccattgtcaccgattttgaggtgactattggttgaattttgaagaggg |
2686315 |
T |
|
| Q |
218 |
ttgtctctg |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
2686316 |
ttgtctctg |
2686324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University