View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13108_high_13 (Length: 499)
Name: NF13108_high_13
Description: NF13108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13108_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 443; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 19 - 481
Target Start/End: Complemental strand, 45107301 - 45106839
Alignment:
| Q |
19 |
attaaaagggttcatttgttaggcattaaattgtttttgccaatttacatgactacaagcacaatgaaggtagaatatggattttggagatcatcatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107301 |
attaaaagggttcatttgttaggcattaaattgtttttgccaatttacatgactacaagcacaatgaaggtagaatatggattttggagatcatcatatt |
45107202 |
T |
|
| Q |
119 |
caggatcaacacttgagacttctctgtttgttttatttacgggttattttttaaaaatggtagcatgctttctatcttcactcattttcaacatgccttt |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107201 |
caggatcaacacttgagacttctttgtttgttttatttactggttattttttaaaaatggtagcatgctttctatcttcactcattttcaacatgccttt |
45107102 |
T |
|
| Q |
219 |
aaaggatggtatctcccttgccctacttttgaactgcaaaggtgttgtggaagtaaacatgtactctaccgcattggatagaaatgtaagtactaaaatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45107101 |
aaaggatggtatctcccttgccctacttttgaactgcaaaggtgttgtggaagtaaacatgtactctaccgcattggatagaaatgtatgtactaaaatc |
45107002 |
T |
|
| Q |
319 |
tctccccttcatcacacacattttctagggaaaaaattgaattaaccgtagaaattgagtatgcttttatttttaattttctgttcttgatcaaatatac |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45107001 |
tctccccttcatcacacacattttctagggaaaaaattgaattaaccgtagaaattgagtatgcttttattttaaattttctgttcttgatcaaatatac |
45106902 |
T |
|
| Q |
419 |
ttttgaatgcaggatatccgtccgaaaatatattgtgtggttatattcataatcatggtttca |
481 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45106901 |
ttatgaatgcaggatatccgtccgaaaatatattgtgtggttatattcataatcatggtttca |
45106839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University