View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13108_high_33 (Length: 238)

Name: NF13108_high_33
Description: NF13108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13108_high_33
NF13108_high_33
[»] chr6 (1 HSPs)
chr6 (1-80)||(9411091-9411170)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 9411170 - 9411091
Alignment:
1 tgatttgtgttccaaaaatagagaactctgcttgcttaatggatgccttgtttactagtattttaaaaagctctgctaaa 80  Q
    ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||    
9411170 tgatttgtgttccaaaaatagagaactcttcttgcgtaatggatgccttgtttactagtattttgaaaagctctgctaaa 9411091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University