View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13108_low_23 (Length: 343)
Name: NF13108_low_23
Description: NF13108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13108_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 24883559 - 24883246
Alignment:
| Q |
18 |
gtgagattgtttaccaacttgaacaaatcgataacnnnnnnn-tataatttgccctcgcaactgctttaggtggggggaatatggtgaaaatatttggca |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883559 |
gtgagattatttaccaacttgaacaaatcgataacaaaaaaaatataatttgccctcgc------tttaggtggggggaatatggtgaaaatatttggca |
24883466 |
T |
 |
| Q |
117 |
catatttgttgcttatctaattcttgtagagacatggacaattttgggattttgggacttaattgaaccatannnnnnnn--agggatccatatattaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
24883465 |
catatttgttgcttatctaattcttgtagagacatggaaaattttggga--------cttaattgaaccatatattttttttagggatccatatattaat |
24883374 |
T |
 |
| Q |
215 |
ttttattatggtattgttgcaaagaaaatgtctcgagtattttgtgtatgattgtgtggagtctttggaaaattcgtaacttaaattttttggatgagat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24883373 |
ttttattatggtattgttgcaaagaaaatgtctcgagtattttgtgtatgattgtgtggagtctttggaaaagtcgtaacttaaattttttggatgagat |
24883274 |
T |
 |
| Q |
315 |
aatggagttcgggtatgtttcatttagg |
342 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
24883273 |
aatggagttcgggtatgttccatttagg |
24883246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University