View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13108_low_42 (Length: 224)
Name: NF13108_low_42
Description: NF13108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13108_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 43633103 - 43632888
Alignment:
| Q |
1 |
attaccagaagaacatctaacagaaaagacagaaacttttgcagaggtgtgtggcggcgccttggaaccaaagaggtcattgaaagaaaaagtgaaggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43633103 |
attaccagaagaacatctaacagaaaagacagaaacttttgcagaggtgtgtggcggcgccttggaaccaaagaggtcattgaaagaaaaagtgaaggcc |
43633004 |
T |
 |
| Q |
101 |
aaggcttttgttgccattaatatgtttctttcttctcaatgaagctgagaacaacgttacacagagatatgtctgag-nnnnnnnnccaaaccagtgtta |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43633003 |
aaagcttttgttgccattaatatgtttctttcttctcaatgaagctgagaacaacgttacacagagatatgtctgagaaaaaaaaaccaaaccagtgtta |
43632904 |
T |
 |
| Q |
200 |
gcagcagcaacctatg |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43632903 |
gcagcagcaacctatg |
43632888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University