View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13109_high_37 (Length: 201)
Name: NF13109_high_37
Description: NF13109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13109_high_37 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 35 - 201
Target Start/End: Original strand, 40631800 - 40631965
Alignment:
| Q |
35 |
gtaacaattttcttttagttgaatatattttggatgagcaagtctctgttgctccctagtttnnnnnnnnngttttaagtttttatattcgtcaataaca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40631800 |
gtaacaattttcttttagttgaatatattttggatgagcaagcctctgttgctccctagtttaaaaaaaa-gttttaagtttttatattcgtcaataaca |
40631898 |
T |
 |
| Q |
135 |
tgggtttataaagttttacattaccttgatatcattaagtcaaaaacatgaagtctatagggtttta |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40631899 |
tgggtttataaagttttacattactttgatatcattaagtcaaaaacatgaagtctatagagtttta |
40631965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 19345879 - 19345932
Alignment:
| Q |
42 |
ttttcttttagttgaatatattttggatgagcaagtctctgttgctccctagttt |
96 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
19345879 |
ttttctttt-gttgaatatattttgggtgagcaagcctctgctgctccctagttt |
19345932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University